{
  "total": 163,
  "topics": [
    {
      "id": 460378,
      "title": "Thanks from the hosts, and next steps!",
      "comment_count": 9,
      "views": 0,
      "votes": 20
    },
    {
      "id": 460135,
      "title": "Recap of Competition - Congratulations to the Winners!",
      "comment_count": 5,
      "views": 0,
      "votes": 9
    },
    {
      "id": 444653,
      "title": "How to check if your model generalizes to long sequences",
      "comment_count": 78,
      "views": 0,
      "votes": 60
    },
    {
      "id": 437481,
      "title": "Welcome to the Ribonanza Challenge!",
      "comment_count": 55,
      "views": 0,
      "votes": 37
    },
    {
      "id": 437931,
      "title": "This Competition has an Official Discord Channel",
      "comment_count": 0,
      "views": 0,
      "votes": 2
    },
    {
      "id": 460403,
      "title": "[3rd Place Solution] AlphaFold Style Twin Tower Architecture + Squeezeformer",
      "comment_count": 19,
      "views": 0,
      "votes": 24
    },
    {
      "id": 463352,
      "title": "10th Place Solution for the Stanford Ribonanza RNA Folding Competition",
      "comment_count": 3,
      "views": 0,
      "votes": 13
    },
    {
      "id": 494029,
      "title": "Data availability",
      "comment_count": 0,
      "views": 0,
      "votes": 0
    },
    {
      "id": 480778,
      "title": "Preprint on Ribonanza research is out!",
      "comment_count": 0,
      "views": 0,
      "votes": 4
    },
    {
      "id": 475103,
      "title": "Seminar on Ribonanza outcome: Tuesday, 13 February, 2024",
      "comment_count": 0,
      "views": 0,
      "votes": 4
    },
    {
      "id": 460121,
      "title": "[1st place solution] Transformer model with Dynamic positional encoding + CNN for BPPM features",
      "comment_count": 58,
      "views": 0,
      "votes": 147
    },
    {
      "id": 464178,
      "title": "Given reactivity values, how to infer RNA-structures?",
      "comment_count": 1,
      "views": 0,
      "votes": null
    },
    {
      "id": 460190,
      "title": "7th place solution",
      "comment_count": 32,
      "views": 0,
      "votes": 44
    },
    {
      "id": 462850,
      "title": "Help us train RibonanzaNet, a single model that integrates all of our efforts! [NEEDED BY DEC 24 2023: Labels for train sequences]",
      "comment_count": 19,
      "views": 0,
      "votes": 5
    },
    {
      "id": 463253,
      "title": "[37th place solution🥈] Single Graph Transformer + Gated GCN Model",
      "comment_count": 0,
      "views": 0,
      "votes": 1
    },
    {
      "id": 462452,
      "title": "Data update",
      "comment_count": 0,
      "views": 0,
      "votes": 8
    },
    {
      "id": 462838,
      "title": "403rd Place Solution for the Stanford Ribonanza RNA Folding Competition",
      "comment_count": 0,
      "views": 0,
      "votes": 2
    },
    {
      "id": 460193,
      "title": "Visualizing the leaderboard dynamics",
      "comment_count": 13,
      "views": 0,
      "votes": 33
    },
    {
      "id": 461545,
      "title": "20th place solution",
      "comment_count": 1,
      "views": 0,
      "votes": 6
    },
    {
      "id": 460316,
      "title": "2nd place solution - Squeezeformer + BPP Conv2D Attention",
      "comment_count": 17,
      "views": 0,
      "votes": 42
    },
    {
      "id": 461726,
      "title": "419th: Tensorflow and additionally ( Vienna RNA, Scikit Learn and XG Boost)",
      "comment_count": 0,
      "views": 0,
      "votes": 2
    },
    {
      "id": 461518,
      "title": "60th Place Solution: transformer with a decoder layer, which accepts two types of information [with code]",
      "comment_count": 0,
      "views": 0,
      "votes": 3
    },
    {
      "id": 460285,
      "title": "21th solution: ESM2 + custom folding head",
      "comment_count": 9,
      "views": 0,
      "votes": 23
    },
    {
      "id": 460956,
      "title": "8 Place Solution(ONODERA part)",
      "comment_count": 1,
      "views": 0,
      "votes": 8
    },
    {
      "id": 460287,
      "title": "36th solution : Cheap Transformers that can run on gaming laptops and does not require a BPP matrix",
      "comment_count": 3,
      "views": 0,
      "votes": 19
    },
    {
      "id": 460401,
      "title": "58th solution: simple Roformer model",
      "comment_count": 5,
      "views": 0,
      "votes": 16
    },
    {
      "id": 460904,
      "title": "Approximately 22nd Place Solution",
      "comment_count": 2,
      "views": 0,
      "votes": 8
    },
    {
      "id": 460222,
      "title": "8th place solution (KF Part)",
      "comment_count": 2,
      "views": 0,
      "votes": 27
    },
    {
      "id": 460301,
      "title": "Host solution (RNAdegformer public/private 0.1437/0.1458) and some insights",
      "comment_count": 11,
      "views": 0,
      "votes": 23
    },
    {
      "id": 460203,
      "title": "4th place solution",
      "comment_count": 7,
      "views": 0,
      "votes": 29
    },
    {
      "id": 460545,
      "title": "16th Place Solution",
      "comment_count": 0,
      "views": 0,
      "votes": 12
    },
    {
      "id": 461072,
      "title": "184th Place Solution ESM2 (2 models) using RMDB + QUICK_START datasets",
      "comment_count": 0,
      "views": 0,
      "votes": 2
    },
    {
      "id": 460130,
      "title": "15th place solution",
      "comment_count": 4,
      "views": 0,
      "votes": 21
    },
    {
      "id": 460250,
      "title": "5th Place Solution",
      "comment_count": 2,
      "views": 0,
      "votes": 17
    },
    {
      "id": 460192,
      "title": "11th place solution: Transformer with MFE distance embeddings (with code)",
      "comment_count": 1,
      "views": 0,
      "votes": 16
    },
    {
      "id": 460145,
      "title": "19th Solution",
      "comment_count": 2,
      "views": 0,
      "votes": 17
    },
    {
      "id": 460202,
      "title": "Congrats to new Competition GM",
      "comment_count": 3,
      "views": 0,
      "votes": 13
    },
    {
      "id": 460172,
      "title": "Best train-data-only scores?",
      "comment_count": 5,
      "views": 0,
      "votes": 7
    },
    {
      "id": 460252,
      "title": "GraphAttention solution approach",
      "comment_count": 0,
      "views": 0,
      "votes": 10
    },
    {
      "id": 460355,
      "title": "22th place solution (A simplest CNN)",
      "comment_count": 0,
      "views": 0,
      "votes": 8
    },
    {
      "id": 460383,
      "title": "[18th place solution] Transformer + bpp conv + relative position bias",
      "comment_count": 0,
      "views": 0,
      "votes": 6
    },
    {
      "id": 459634,
      "title": "[Fun Fact] Barrier around 0.138, 0.139 and 0.141.",
      "comment_count": 14,
      "views": 0,
      "votes": 12
    },
    {
      "id": 460277,
      "title": "81st Place Solution for the Stanford Ribonanza RNA Folding Competition",
      "comment_count": 0,
      "views": 0,
      "votes": 4
    },
    {
      "id": 460257,
      "title": "[93th place solution] BPP as embedding layer",
      "comment_count": 0,
      "views": 0,
      "votes": 4
    },
    {
      "id": 458478,
      "title": "[Fun Fact] Barrier around 0.141.",
      "comment_count": 6,
      "views": 0,
      "votes": 21
    },
    {
      "id": 460315,
      "title": "44th Place Solution for the Stanford Ribonanza RNA Folding Competition",
      "comment_count": 0,
      "views": 0,
      "votes": 3
    },
    {
      "id": 460116,
      "title": "What the hell just happened!!!!!!!",
      "comment_count": 4,
      "views": 0,
      "votes": 2
    },
    {
      "id": 460200,
      "title": "GG everyone!",
      "comment_count": 0,
      "views": 0,
      "votes": 3
    },
    {
      "id": 460131,
      "title": "god!!!!!!!!",
      "comment_count": 0,
      "views": 0,
      "votes": 1
    },
    {
      "id": 460108,
      "title": "Don't we have until midnight?",
      "comment_count": 1,
      "views": 0,
      "votes": 1
    },
    {
      "id": 459977,
      "title": "Detect and Init TPU",
      "comment_count": 1,
      "views": 0,
      "votes": null
    },
    {
      "id": 459077,
      "title": "Reactivity_xxx and Reactivity_dms_Map relation",
      "comment_count": 7,
      "views": 0,
      "votes": 1
    },
    {
      "id": 457459,
      "title": "Biological Solutions to Climate Change?",
      "comment_count": 3,
      "views": 0,
      "votes": 4
    },
    {
      "id": 455715,
      "title": "What are your expectations of shakeup?",
      "comment_count": 12,
      "views": 0,
      "votes": 9
    },
    {
      "id": 458956,
      "title": "How to pass floating point values to nn.embeddings",
      "comment_count": 3,
      "views": 0,
      "votes": 1
    },
    {
      "id": 458076,
      "title": "Pseudo-labeling?",
      "comment_count": 5,
      "views": 0,
      "votes": 4
    },
    {
      "id": 458409,
      "title": "Cool talk from the covid-19 mRNA vaccine competition.",
      "comment_count": 0,
      "views": 0,
      "votes": 2
    },
    {
      "id": 458121,
      "title": "Improving Generalization ",
      "comment_count": 4,
      "views": 0,
      "votes": 3
    },
    {
      "id": 455492,
      "title": "Have there been similar competitions in the past?",
      "comment_count": 3,
      "views": 0,
      "votes": 7
    },
    {
      "id": 456079,
      "title": "Anyone tried augmented bpp's from vienna, eternafold and others?",
      "comment_count": 15,
      "views": 0,
      "votes": 6
    },
    {
      "id": 457575,
      "title": "Flipping the sequence as a form of data augmentation?",
      "comment_count": 2,
      "views": 0,
      "votes": 1
    },
    {
      "id": 455344,
      "title": "RuntimeError: mat1 and mat2 shapes cannot be multiplied",
      "comment_count": 2,
      "views": 0,
      "votes": null
    },
    {
      "id": 449093,
      "title": "THE MEMES HERE! 🤡 Post your meme~~~",
      "comment_count": 8,
      "views": 0,
      "votes": 17
    },
    {
      "id": 457139,
      "title": "How much the 'last dense layer' impacts to the entire result?",
      "comment_count": 11,
      "views": 0,
      "votes": null
    },
    {
      "id": 457030,
      "title": "3-D Structure from Reactivities",
      "comment_count": 2,
      "views": 0,
      "votes": 2
    },
    {
      "id": 454377,
      "title": "Parquet submissions temporarily disabled [obsolete]",
      "comment_count": 4,
      "views": 0,
      "votes": 9
    },
    {
      "id": 456357,
      "title": "How is \"signal_to_noise\" calculated?",
      "comment_count": 5,
      "views": 0,
      "votes": 3
    },
    {
      "id": 456180,
      "title": "Scoring of flanking regions",
      "comment_count": 3,
      "views": 0,
      "votes": 5
    },
    {
      "id": 455578,
      "title": "Notebook restart 2times",
      "comment_count": 2,
      "views": 0,
      "votes": 2
    },
    {
      "id": 451853,
      "title": "Modeling with 3D coordinates ",
      "comment_count": 17,
      "views": 0,
      "votes": 25
    },
    {
      "id": 454397,
      "title": "External data from RNA Mapping DataBase",
      "comment_count": 7,
      "views": 0,
      "votes": 19
    },
    {
      "id": 455676,
      "title": "Protein Folding vs RNA Folding",
      "comment_count": 2,
      "views": 0,
      "votes": 1
    },
    {
      "id": 455173,
      "title": "How to boost the prediction ?",
      "comment_count": 12,
      "views": 0,
      "votes": 2
    },
    {
      "id": 454999,
      "title": "about data augumentation",
      "comment_count": 7,
      "views": 0,
      "votes": 6
    },
    {
      "id": 454953,
      "title": "RNA Biology with Eterna -- free Coursera course",
      "comment_count": 0,
      "views": 0,
      "votes": 11
    },
    {
      "id": 455431,
      "title": "Ubr Walkthrough results",
      "comment_count": 0,
      "views": 0,
      "votes": 3
    },
    {
      "id": 455660,
      "title": "Why I cannot launch a session notebook, a message appears many times Are you still here ?",
      "comment_count": 8,
      "views": 0,
      "votes": 1
    },
    {
      "id": 454546,
      "title": "Intuition behind clipped/constrained predictions not training. ",
      "comment_count": 5,
      "views": 0,
      "votes": 5
    },
    {
      "id": 454773,
      "title": "What are the input, label ?",
      "comment_count": 12,
      "views": 0,
      "votes": 2
    },
    {
      "id": 455109,
      "title": "So what do you have to do here, exactly?",
      "comment_count": 0,
      "views": 0,
      "votes": 1
    },
    {
      "id": 454575,
      "title": "Gibbs modified attention",
      "comment_count": 0,
      "views": 0,
      "votes": 4
    },
    {
      "id": 453611,
      "title": "All codons appeared in train data",
      "comment_count": 4,
      "views": 0,
      "votes": 4
    },
    {
      "id": 453660,
      "title": "Beginner question: can you use models you trained locally?",
      "comment_count": 3,
      "views": 0,
      "votes": 6
    },
    {
      "id": 453738,
      "title": "Rescores are in progress - COMPLETE!",
      "comment_count": 2,
      "views": 0,
      "votes": 4
    },
    {
      "id": 447895,
      "title": "Make Use of Structure",
      "comment_count": 6,
      "views": 0,
      "votes": 1
    },
    {
      "id": 440702,
      "title": "The best single model",
      "comment_count": 50,
      "views": 0,
      "votes": 66
    },
    {
      "id": 453147,
      "title": "Theoretical differences in RNA seq from length 115 to 206 vs RNA seq from length 207 to 457",
      "comment_count": 4,
      "views": 0,
      "votes": 2
    },
    {
      "id": 437706,
      "title": "New to Kaggle or Machine Learning? Check this out ~",
      "comment_count": 10,
      "views": 0,
      "votes": 6
    },
    {
      "id": 451890,
      "title": "Ribonanza data update and quick starter",
      "comment_count": 8,
      "views": 0,
      "votes": 12
    },
    {
      "id": 451448,
      "title": "Reactivity value and errors",
      "comment_count": 13,
      "views": 0,
      "votes": 4
    },
    {
      "id": 452581,
      "title": "How to replicate fastai's fit_one_cycle in pytorch?",
      "comment_count": 3,
      "views": 0,
      "votes": 1
    },
    {
      "id": 451158,
      "title": "Reactivity errors of 2A3 equals to those of DMS",
      "comment_count": 13,
      "views": 0,
      "votes": 25
    },
    {
      "id": 452061,
      "title": "RESOLVED - \"Download All\" and API download issues",
      "comment_count": 1,
      "views": 0,
      "votes": 5
    },
    {
      "id": 437707,
      "title": "Looking for a Team Megathread",
      "comment_count": 160,
      "views": 0,
      "votes": 9
    },
    {
      "id": 451881,
      "title": "Running TPU notebook on Colab",
      "comment_count": 2,
      "views": 0,
      "votes": 4
    },
    {
      "id": 451968,
      "title": "RNA Folding: Research papers on ML models to predict the structures of RNA molecule",
      "comment_count": 0,
      "views": 0,
      "votes": 3
    },
    {
      "id": 452031,
      "title": "US exec order??/?",
      "comment_count": 0,
      "views": 0,
      "votes": 1
    },
    {
      "id": 451823,
      "title": "Using ChatGPT to understand better the challenges underlying the competition and the approach taken by some of the participants with the most votes ",
      "comment_count": 2,
      "views": 0,
      "votes": 1
    },
    {
      "id": 449084,
      "title": "Out of ideas",
      "comment_count": 8,
      "views": 0,
      "votes": 6
    },
    {
      "id": 441504,
      "title": "EternaFold zip download link not working?  ",
      "comment_count": 3,
      "views": 0,
      "votes": 1
    },
    {
      "id": 451668,
      "title": "Seeing new train_data",
      "comment_count": 1,
      "views": 0,
      "votes": null
    },
    {
      "id": 448946,
      "title": "Role of RNA folding plays in climate change ",
      "comment_count": 3,
      "views": 0,
      "votes": 3
    },
    {
      "id": 450692,
      "title": "[Mistake Resolved]",
      "comment_count": 9,
      "views": 0,
      "votes": 3
    },
    {
      "id": 451036,
      "title": "Could you recommend me sites to subscribe GPU?",
      "comment_count": 3,
      "views": 0,
      "votes": 2
    },
    {
      "id": 448959,
      "title": "duplicated samples in training dataset ",
      "comment_count": 7,
      "views": 0,
      "votes": 4
    },
    {
      "id": 448918,
      "title": "Private leaderboard availability ",
      "comment_count": 1,
      "views": 0,
      "votes": null
    },
    {
      "id": 448463,
      "title": "Using Kaggle notebooks",
      "comment_count": 4,
      "views": 0,
      "votes": 3
    },
    {
      "id": 437794,
      "title": "🥇Papers for this Competition [with Code]🔥",
      "comment_count": 5,
      "views": 0,
      "votes": 44
    },
    {
      "id": 448296,
      "title": "Reducing data usage.",
      "comment_count": 3,
      "views": 0,
      "votes": 0
    },
    {
      "id": 448474,
      "title": "new paper, seems relevant",
      "comment_count": 0,
      "views": 0,
      "votes": 2
    },
    {
      "id": 448430,
      "title": "Hard coded rules for null values in reactivity profile?",
      "comment_count": 1,
      "views": 0,
      "votes": 1
    },
    {
      "id": 444621,
      "title": "RNA 3D structure seminar series",
      "comment_count": 2,
      "views": 0,
      "votes": 8
    },
    {
      "id": 445415,
      "title": "Experimental protocol behind the data",
      "comment_count": 1,
      "views": 0,
      "votes": 15
    },
    {
      "id": 447231,
      "title": "Sequences from RFAM",
      "comment_count": 1,
      "views": 0,
      "votes": 3
    },
    {
      "id": 446900,
      "title": "RNA Ensembles",
      "comment_count": 0,
      "views": 0,
      "votes": 15
    },
    {
      "id": 446223,
      "title": "Quicker workflow for iteration?",
      "comment_count": 3,
      "views": 0,
      "votes": 1
    },
    {
      "id": 445242,
      "title": "Is BPPs useful for our predictions?",
      "comment_count": 1,
      "views": 0,
      "votes": 5
    },
    {
      "id": 445348,
      "title": "Rescores are in progress - COMPLETED",
      "comment_count": 2,
      "views": 0,
      "votes": 4
    },
    {
      "id": 441122,
      "title": "Train data reactivity columns are null?",
      "comment_count": 4,
      "views": 0,
      "votes": 1
    },
    {
      "id": 445730,
      "title": "I cannot submit my projects ",
      "comment_count": 3,
      "views": 0,
      "votes": null
    },
    {
      "id": 442993,
      "title": "Transformer training diverges",
      "comment_count": 5,
      "views": 0,
      "votes": 3
    },
    {
      "id": 444368,
      "title": "Sequence Reliability",
      "comment_count": 1,
      "views": 0,
      "votes": 4
    },
    {
      "id": 445439,
      "title": "How to Make Use of Reactivity Error?",
      "comment_count": 0,
      "views": 0,
      "votes": 0
    },
    {
      "id": 442668,
      "title": "Value of \"additional folders\"",
      "comment_count": 2,
      "views": 0,
      "votes": 4
    },
    {
      "id": 444226,
      "title": "Question about RNA experiments - any post-transcriptional modifications?",
      "comment_count": 1,
      "views": 0,
      "votes": 1
    },
    {
      "id": 444306,
      "title": "Train of length 206 - only 3 core sequences - CORONOVIRUS (?) -  with only small variations around - seems NOT similar to private test",
      "comment_count": 0,
      "views": 0,
      "votes": 5
    },
    {
      "id": 438695,
      "title": "What is reactivity ?",
      "comment_count": 11,
      "views": 0,
      "votes": 2
    },
    {
      "id": 443168,
      "title": "🕸️ Graph neural network approaches - with starter notebook 🕸️",
      "comment_count": 1,
      "views": 0,
      "votes": 7
    },
    {
      "id": 442856,
      "title": "What type of RNA data is used??",
      "comment_count": 4,
      "views": 0,
      "votes": 1
    },
    {
      "id": 437850,
      "title": "Beginner Question – What is the target?",
      "comment_count": 15,
      "views": 0,
      "votes": 2
    },
    {
      "id": 443574,
      "title": "Submission File: Float Precision for MAE Error",
      "comment_count": 2,
      "views": 0,
      "votes": null
    },
    {
      "id": 443599,
      "title": "What is id_min and id_max ?",
      "comment_count": 2,
      "views": 0,
      "votes": null
    },
    {
      "id": 443362,
      "title": "What are reactivity error columns?",
      "comment_count": 1,
      "views": 0,
      "votes": 2
    },
    {
      "id": 442561,
      "title": "First 34 nucleotides are dominated by sequence GGGAACGACUCGAGUAGAGUCGAAAAGAUAUGGA - why ?",
      "comment_count": 1,
      "views": 0,
      "votes": 5
    },
    {
      "id": 442828,
      "title": "How the start-end positions with UNKNOWN groundtruth are scored on public LB ? (Excluded or fill by zero or ...? )",
      "comment_count": 4,
      "views": 0,
      "votes": 2
    },
    {
      "id": 443344,
      "title": "Upper Bound for Sequence Input",
      "comment_count": 1,
      "views": 0,
      "votes": null
    },
    {
      "id": 442854,
      "title": "The Final Output of This Competition",
      "comment_count": 2,
      "views": 0,
      "votes": null
    },
    {
      "id": 443186,
      "title": "Are multiple models allowed?",
      "comment_count": 2,
      "views": 0,
      "votes": null
    },
    {
      "id": 442411,
      "title": "Motivation",
      "comment_count": 1,
      "views": 0,
      "votes": 2
    },
    {
      "id": 441990,
      "title": "Time taken for the test data",
      "comment_count": 4,
      "views": 0,
      "votes": 1
    },
    {
      "id": 441720,
      "title": "a long list of questions",
      "comment_count": 4,
      "views": 0,
      "votes": 4
    },
    {
      "id": 437766,
      "title": "Adjutant onboarding materials",
      "comment_count": 3,
      "views": 0,
      "votes": 12
    },
    {
      "id": 442609,
      "title": "Stanford Ribonanza RNA Folding Discussion",
      "comment_count": 0,
      "views": 0,
      "votes": 0
    },
    {
      "id": 442347,
      "title": "interesting paper",
      "comment_count": 0,
      "views": 0,
      "votes": 1
    },
    {
      "id": 437787,
      "title": "Beginner issue: How to open the huge train_data.csv? Cannot open in excel or Notepad++",
      "comment_count": 4,
      "views": 0,
      "votes": 2
    },
    {
      "id": 441887,
      "title": "Data format in submission.csv",
      "comment_count": 3,
      "views": 0,
      "votes": null
    },
    {
      "id": 440698,
      "title": "Simple Clustering of the RNA sequences as a minimal start?",
      "comment_count": 3,
      "views": 0,
      "votes": 4
    },
    {
      "id": 441119,
      "title": "Beginner Introduction to RNA Folding",
      "comment_count": 0,
      "views": 0,
      "votes": 5
    },
    {
      "id": 437731,
      "title": "Protein Structure Prediction: CASP. AlphaFold. Highlights on Kaggle Competitions.",
      "comment_count": 13,
      "views": 0,
      "votes": 36
    },
    {
      "id": 438766,
      "title": "A Comprehensive Guide to Approaches and Challenges in RNA Structure Prediction",
      "comment_count": 2,
      "views": 0,
      "votes": 25
    },
    {
      "id": 438415,
      "title": "RNA starter [0.186 LB]",
      "comment_count": 0,
      "views": 0,
      "votes": 47
    },
    {
      "id": 438345,
      "title": "How To Map Reactivity to the Sequence",
      "comment_count": 6,
      "views": 0,
      "votes": 13
    },
    {
      "id": 440444,
      "title": "What am I to use the sample_submission.csv for?",
      "comment_count": 2,
      "views": 0,
      "votes": null
    },
    {
      "id": 439155,
      "title": "Confused about variables used to predict reactivity",
      "comment_count": 4,
      "views": 0,
      "votes": null
    },
    {
      "id": 439094,
      "title": "CV - LB calibration",
      "comment_count": 1,
      "views": 0,
      "votes": null
    },
    {
      "id": 437965,
      "title": "RNA post-translational modifications",
      "comment_count": 7,
      "views": 0,
      "votes": 7
    },
    {
      "id": 437897,
      "title": "GNN for RNA",
      "comment_count": 2,
      "views": 0,
      "votes": 9
    },
    {
      "id": 437864,
      "title": "ChatGPT ideas - might be not so bad",
      "comment_count": 3,
      "views": 0,
      "votes": 10
    },
    {
      "id": 438554,
      "title": "Aminoacids Dataset 🧬",
      "comment_count": 0,
      "views": 0,
      "votes": 3
    },
    {
      "id": 438373,
      "title": "Beginner issue: Running out of memory on kaggle notebook",
      "comment_count": 4,
      "views": 0,
      "votes": 3
    },
    {
      "id": 438155,
      "title": " Exploratory Data Analysis (EDA) using ydata-profiling (previously pandas-profiling)",
      "comment_count": 2,
      "views": 0,
      "votes": 4
    },
    {
      "id": 438111,
      "title": "Regarding licenses and restrictions",
      "comment_count": 1,
      "views": 0,
      "votes": 5
    },
    {
      "id": 438511,
      "title": "submission format",
      "comment_count": 1,
      "views": 0,
      "votes": null
    }
  ],
  "errors": []
}